Bedtools coverage란 ?


Bedtools coverage는 A파일과 B파일의 범위와 깊이(features) 을 계산해 주는 tool 입니다.

좀 더 정확하게 말하자면 다음과 같은 4가지 요소를 알 수 있습니다.

1. 겹쳐지는 feature 의 수 (depth)

2. A파일에 대한 B파일의 적용 범위

3. A파일 feature의 길이

4. 백분율 


다음 그림을 보시면 조금 더 이해가 쉬우실 것 같습니다.







Usage


bedtools coverage [Options] –a <File A>  –b <FIle B...> > output


★ File 형식으로는 BAM, BED, GFF, VCF 파일을 사용 할 수 있습니다.


OptionDescription
-aBAM/BED/GFF/VCF file “A”. Each feature in A is compared to B in search of overlaps. Use “stdin” if passing A with a UNIX pipe.
-bOne or more BAM/BED/GFF/VCF file(s) “B”. Use “stdin” if passing B with a UNIX pipe. NEW!!!: -b may be followed with multiple databases and/or wildcard (*) character(s).
-abamBAM file A. Each BAM alignment in A is compared to B in search of overlaps. Use “stdin” if passing A with a UNIX pipe: For example: samtools view -b <BAM> | bedtools intersect -abam stdin -b genes.bed. Note: no longer necessary after version 2.19.0
-hist
Report a histogram of coverage for each feature in A as well as a summary histogram for _all_ features in A.
Output (tab delimited) after each feature in A:
1) depth
2) # bases at depth
3) size of A
4) % of A at depth
-dReport the depth at each position in each A feature. Positions reported are one based. Each position and depth follow the complete A feature.
-countsOnly report the count of overlaps, don’t compute fraction, etc. Restricted by -f and -r.
-fMinimum overlap required as a fraction of A. Default is 1E-9 (i.e. 1bp).
-FMinimum overlap required as a fraction of B. Default is 1E-9 (i.e., 1bp).
-rRequire that the fraction of overlap be reciprocal for A and B. In other words, if -f is 0.90 and -r is used, this requires that B overlap at least 90% of A and that A also overlaps at least 90% of B.
-eRequire that the minimum fraction be satisfied for A _OR_ B. In other words, if -e is used with -f 0.90 and -F 0.10 this requires that either 90% of A is covered OR 10% of B is covered. Without -e, both fractions would have to be satisfied.
-sForce “strandedness”. That is, only report hits in B that overlap A on the same strand. By default, overlaps are reported without respect to strand.
-SRequire different strandedness. That is, only report hits in B that overlap A on the _opposite_ strand. By default, overlaps are reported without respect to strand.
-splitTreat “split” BAM (i.e., having an “N” CIGAR operation) or BED12 entries as distinct BED intervals.
-sortedFor very large B files, invoke a “sweeping” algorithm that requires position-sorted (e.g., sort -k1,1 -k2,2n for BED files) input. When using -sorted, memory usage remains low even for very large files.
-gSpecify a genome file the defines the expected chromosome order in the input files for use with the -sortedoption.
-headerPrint the header from the A file prior to results.
-sortoutWhen using multiple databases (-b), sort the output DB hits for each record.
-nobufDisable buffered output. Using this option will cause each line of output to be printed as it is generated, rather than saved in a buffer. This will make printing large output files noticeably slower, but can be useful in conjunction with other software tools and scripts that need to process one line of bedtools output at a time.
-iobufFollow with desired integer size of read buffer. Optional suffixes K/M/G supported. Note: currently has no effect with compressed files.





'Bioinformatics' 카테고리의 다른 글

bbmap 세팅 메뉴얼  (0) 2019.01.07
NCBI blast+ local install OS Linux  (0) 2018.12.13
Miso Analysis  (0) 2018.10.29
SAM FILE Format  (0) 2018.10.18
BIGWIG FILE  (0) 2018.10.12

Given two strings s and tt is a substring of s if t is contained as a contiguous collection of symbols in s (as a result, t must be no longer than s).

The position of a symbol in a string is the total number of symbols found to its left, including itself (e.g., the positions of all occurrences of 'U' in "AUGCUUCAGAAAGGUCUUACG" are 2, 5, 6, 15, 17, and 18). The symbol at position i of s is denoted by s[i].

A substring of s can be represented as s[j:k], where j and k represent the starting and ending positions of the substring in s; for example, if s = "AUGCUUCAGAAAGGUCUUACG", then s[2:5]= "UGCU".

The location of a substring s[j:k] is its beginning position j; note that t will have multiple locations in s if it occurs more than once as a substring of s (see the Sample below).

Given: Two DNA strings s and t (each of length at most 1 kbp).

Return: All locations of t as a substring of s


t = "GATATATGCATATACTT"
s = "ATAT"

lengtht =len(t)
lengths =len(s)
index = []
indexplus =[]
for i in range(0,lengtht-lengths):
if t[i:i+lengths]==s:
index.append(i)

for j in range(0,len(index)):
indexplus.append(str(index[j]+1))
print(" ".join(indexplus))

Combing Through the Haystack

Figure 1. The human chromosomes stained with a probe for Alu elements, shown in green.

Finding the same interval of DNA in the genomes of two different organisms (often taken from different species) is highly suggestive that the interval has the same function in both organisms.

We define a motif as such a commonly shared interval of DNA. A common task in molecular biology is to search an organism's genome for a known motif.

The situation is complicated by the fact that genomes are riddled with intervals of DNA that occur multiple times (possibly with slight modifications), called repeats. These repeats occur far more often than would be dictated by random chance, indicating that genomes are anything but random and in fact illustrate that the language of DNA must be very powerful (compare with the frequent reuse of common words in any human language).

The most common repeat in humans is the Alu repeat, which is approximately 300 bp long and recurs around a million times throughout every human genome (see Figure 1). However, Alu has not been found to serve a positive purpose, and appears in fact to be parasitic: when a new Alu repeat is inserted into a genome, it frequently causes genetic disorders.


'Python > rosaland' 카테고리의 다른 글

Mortal Fibonacci Rabbits  (0) 2018.12.05
Consensus and Profile  (0) 2018.12.05
Translating RNA into Protein  (0) 2018.11.30
Mendel's First Law  (0) 2018.11.26
Counting Point Mutations  (0) 2018.11.21

The 20 commonly occurring amino acids are abbreviated by using 20 letters from the English alphabet (all letters except for B, J, O, U, X, and Z). Protein strings are constructed from these 20 symbols. Henceforth, the term genetic string will incorporate protein strings along with DNA strings and RNA strings.

The RNA codon table dictates the details regarding the encoding of specific codons into the amino acid alphabet.

Given: An RNA string s corresponding to a strand of mRNA (of length at most 10 kbp).

Return: The protein string encoded by s


s="AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA"

RintoPro = []
protein = {"UUU":"F", "UUC":"F", "UUA":"L", "UUG":"L",
"UCU":"S", "UCC":"S", "UCA":"S", "UCG":"S",
"UAU":"Y", "UAC":"Y", "UAA":"STOP", "UAG":"STOP",
"UGU":"C", "UGC":"C", "UGA":"STOP", "UGG":"W",
"CUU":"L", "CUC":"L", "CUA":"L", "CUG":"L",
"CCU":"P", "CCC":"P", "CCA":"P", "CCG":"P",
"CAU":"H", "CAC":"H", "CAA":"Q", "CAG":"Q",
"CGU":"R", "CGC":"R", "CGA":"R", "CGG":"R",
"AUU":"I", "AUC":"I", "AUA":"I", "AUG":"M",
"ACU":"T", "ACC":"T", "ACA":"T", "ACG":"T",
"AAU":"N", "AAC":"N", "AAA":"K", "AAG":"K",
"AGU":"S", "AGC":"S", "AGA":"R", "AGG":"R",
"GUU":"V", "GUC":"V", "GUA":"V", "GUG":"V",
"GCU":"A", "GCC":"A", "GCA":"A", "GCG":"A",
"GAU":"D", "GAC":"D", "GAA":"E", "GAG":"E",
"GGU":"G", "GGC":"G", "GGA":"G", "GGG":"G"}



for i in range(s.find('AUG'),len(s),3):
if s[i:i+3]=="UAG" or s[i:i+3] == "UGA" or s[i:i+3] == "UAA":
break
else:
RintoPro.append(protein[s[i:i+3]])
print(''.join(RintoPro))

Figure 1. The human hemoglobin molecule consists of 4 polypeptide chains; α subunits are shown in red and β subunits are shown in blue

Just as nucleic acids are polymers of nucleotidesproteins are chains of smaller molecules called amino acids; 20 amino acids commonly appear in every species. Just as the primary structure of a nucleic acid is given by the order of its nucleotides, the primary structure of a protein is the order of its amino acids. Some proteins are composed of several subchains called polypeptides, while others are formed of a single polypeptide; see Figure 1.

Proteins power every practical function carried out by the cell, and so presumably, the key to understanding life lies in interpreting the relationship between a chain of amino acids and the function of the protein that this chain of amino acids eventually constructs. Proteomics is the field devoted to the study of proteins.

How are proteins created? The genetic code, discovered throughout the course of a number of ingenious experiments in the late 1950s, details thetranslation of an RNA molecule called messenger RNA (mRNA) into amino acids for protein creation. The apparent difficulty in translation is that somehow 4 RNA bases must be translated into a language of 20 amino acids; in order for every possible amino acid to be created, we must translate 3-nucleobase strings (called codons) into amino acids. Note that there are 43=64 possible codons, so that multiple codons may encode the same amino acid. Two special types of codons are the start codon (AUG), which codes for the amino acid methionine always indicates the start of translation, and the three stop codons (UAA, UAG, UGA), which do not code for an amino acid and cause translation to end.

The notion that protein is always created from RNA, which in turn is always created from DNA, forms the central dogma of molecular biology. Like all dogmas, it does not always hold; however, it offers an excellent approximation of the truth.

An organelle called a ribosome creates peptides by using a helper molecule called transfer RNA (tRNA). A single tRNA molecule possesses a string of three RNA nucleotides on one end (called an anticodon) and an amino acid at the other end. The ribosome takes an RNA molecule transcribed from DNA (see “Transcribing DNA into RNA”), called messenger RNA (mRNA), and examines it one codon at a time. At each step, the tRNA possessing the complementary anticodon bonds to the mRNA at this location, and the amino acid found on the opposite end of the tRNA is added to the growing peptide chain before the remaining part of the tRNA is ejected into the cell, and the ribosome looks for the next tRNA molecule.

Not every RNA base eventually becomes translated into a protein, and so an interval of RNA (or an interval of DNA translated into RNA) that does code for a protein is of great biological interest; such an interval of DNA or RNA is called a gene. Because protein creation drives cellular processes, genes differentiate organisms and serve as a basis for heredity, or the process by which traits are inherited.

'Python > rosaland' 카테고리의 다른 글

Consensus and Profile  (0) 2018.12.05
Combing Through the Haystack  (0) 2018.11.30
Mendel's First Law  (0) 2018.11.26
Counting Point Mutations  (0) 2018.11.21
Computing GC Content  (0) 2018.11.21

+ Recent posts